Composite

Part:BBa_K3813005

Designed by: Kay Nagasato   Group: iGEM21_ASIJ_Tokyo   (2021-09-08)


Mucin(MUC 1) with Anderson promoter and T7 Terminator

Part Info

This part can be used to initiate the production of the Mucin 1 biomarker(protein) in an E.Coli cell system. Mucin 1 is an essential biomarker that is beneficial towards the detection of breast cancer. We decided to synthesize Mucin 1 in E.Coli in order to model biomarkers in human breast tissue and apply this for our aptamer experiments.

Construct Design

This is a composite part made up of a combination of previously existing parts from the iGEM registry: Anderson promoter(BBa_J23100) and T7 terminator(BBa_K731721), RBS along with the Mucin 1 gene sequence from NCBI.


Results

We selected the forward and reverse primers for our Mucin protein sequence.

MUC-1: Forward primer GTGCCCCCTAGCAGTACCG Reverse primer GACGTGCCCCTACAAGTTGG

We first used PCR to amplify our protein-coding sequence(found on NCBI) and selected our forward and reverse primers based on an extensive literature review we performed.

We then used Gibson Assembly to construct our part in the iGEM chloramphenicol backbone pSB1C3, before transforming it into E.Coli cells. We used a GFP reporter in our construct to monitor if the Mucin sequence was successfully expressed in our E.Coli cells. Following transformation, we first qualitatively analyzed the plates to see if they were glowing. Since our construct was tagged with GFP, if the biomarker was successfully produced, then our colonies would glow.

Our qualitative analysis observed that there were glowing colonies on all parts of the plate, with relatively large colonies.

T--ASIJ_Tokyo--A2.png

Figure 1: Transformation Results for BBa K3813005. The glowing colonies seen in the picture represent that Mucin was successfully expressed in the system and that we could quantitatively analyze for the amount of protein produced through purification.

Protein Expression and Purification

To further verify our findings, we purified the Mucin that was produced through transformation by applying freezing/cracking before using the regular purification process. This was because the Mucin sequence was relatively large and without a tag, it was difficult to extract the protein out through regular purification. PAGE electrophoresis and readings from the 96-well plate reader indicated the presence of Mucin from this construct.

Analysis of Protein Concentration

To calculate the concentrations of the biomarkers within each well, we first ran the BSA model to create the standard curve, where the x-axis represents absorbance, and y-axis represents the concentration in mg/ml. The standard curve later allowed us to convert the measured absorbance into measurements of concentration. The equation and the image of the standard graph we derived from the BSA model is as follows.

T--ASIJ_Tokyo--BSA_Standard.png

Figure 2: Standard Curve for BSA

Using the standard curve and the measured absorbance, we interpolated values of concentration for each of the different constructs. We performed this conversion by substituting the absorbance values into the x-variable in our standard curve, to find the corresponding y-variable which represents concentration. The post-conversion concentrations of the biomarkers are listed below.

For construct BBa_K3813005, we will not present the value here as it was incalculable under the BSA model. We decided to omit any results that were impossible to extrapolate from the concentration vs absorbance standard curve because doing so would be statistical extrapolation of the BSA model.

References

[1] Wang, Y., Kirpich, I., Liu, Y., Ma, Z., Barve, S., McClain, C. J., & Feng, W. (2011). Lactobacillus rhamnosus GG treatment potentiates intestinal hypoxia-inducible factor, promotes intestinal integrity and ameliorates alcohol-induced liver injury. The American Journal of Pathology, 179(6), 2866–2875.

[2]Homo sapiens chromosome 1, GRCh38.p13 Primary Assembly - Nucleotide - NCBI. (n.d.). Retrieved August 2, 2021, from https://www.ncbi.nlm.nih.gov/nuccore/NC_000001.11?report=fasta&from=155185824&to=155192915&strand=true


Sequence and Features No part name specified with partinfo tag.


[edit]
Categories
Parameters
None